« Back
Home /
SiRNA Negative Control

SiRNA Negative Control

€521.00

Excl. VAT

Item no.	HY-150150-5mg
Manufacturer	MedChem Express
Amount	5 mg
Category	Reagents & Chemicals Biochemicals Controls
Type	Control
Specific against	other
Purity	96.40
Smiles	[RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA) (1:1)]
ECLASS 10.1	42021590
ECLASS 11.0	42021590
UNSPSC	41105330
Available
Product Description	SiRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control.
StorageTemperature	-20°C (Powder, sealed storage, away from moisture)
Shipping	Blue Ice
Manufacturers Applications	COVID-19-immunoregulation
Molecular Weight	13323 ( AS: 6586.9; SS: 6736.1 )
Clinical Information	No Development Reported
Solubility	H2O : 100 mg/mL (ultrasonic)
Pathway	Epigenetics
Manufacturers Product type	Oligonucleotides

Note: The presented information and documents (Manual, Product Datasheet, Safety Datasheet and Certificate of Analysis) correspond to our latest update and should serve for orientational purpose only. We do not guarantee the topicality. We would kindly ask you to make a request for specific requirements, if necessary.

All products are intended for research use only (RUO). Not for human, veterinary or therapeutic use.

Request Data Sheet

Request product datasheet

Request safety datasheet

Simple Order Order Subscription

Amount: 5 mg

Listprice: €521.00

Price: €521.00

available

Quantity:

Compare

Add to wishlist